Tutorial ========= Use Chorus2 to design oligo probes for plant genome ------------------------------------------------------------ In this tutorial, we will build oligo probe set for Arabidopsis genome. Install Chorus2 ****************************** See install tutorial here_ .. _here: install.html Run Chorus2 ****************************** Run Chorus2 with Docker ^^^^^^^^^^^^^^^^^^^^^^^^^^ **Download Reference Genome file** .. code-block:: bash $ wget https://www.arabidopsis.org/download_files/Genes/TAIR10_genome_release/TAIR10_chromosome_files/TAIR10_chr_all.fas $ docker run -v $PWD:/home/chorus -e CHORUS_USER=$USER -e CHORUS_UID=$UID \ forrestzhang/docker-chorus -i TAIR10_chr_all.fas -g TAIR10_chr_all.fas -t 12 Please wait unit all precess done. There are some logs: .. code-block:: log forrest /home/chorus use local user: forrest Adding group 'forrest' (GID 1000) ... Done. Adding user 'forrest' ... Adding new user 'forrest' (1000) with group 'forrest' ... Creating home directory '/home/forrest' ... Copying files from '/etc/skel' ... /home/chorus exists 2.2.3 ######################################## bwa version: /opt/software/bwa/bwa 0.7.12-r1044 jellyfish version: /opt/software/jellyfish/bin/jellyfish 2.2.3 genome file: TAIR10_chr_all.fas input file: TAIR10_chr_all.fas 5' labeled R primer: result output folder: /home/chorus/probes threads number: 12 homology: 75 dtm: 10 ######################################## ... ... 14300000 / 14326857 14310000 / 14326857 14320000 / 14326857 Job finshed!! When process done: .. code-block:: bash $ ls -lt probes/ total 1741428 -rw-r--r-- 1 root root 280927981 Aug 24 17:44 TAIR10_chr_all.fas_all.bed -rw-r--r-- 1 root root 62050561 Aug 24 17:44 TAIR10_chr_all.fas.bed -rw-r--r-- 1 root root 94 Aug 24 17:30 TAIR10_chr_all.fas.len -rw-r--r-- 1 root root 1031512169 Aug 24 17:22 TAIR10_chr_all.fas_tmp_probe.fa -rw-r--r-- 1 root root 59833928 Aug 24 17:19 TAIR10_chr_all.fas.sa -rw-r--r-- 1 root root 7535 Aug 24 17:18 TAIR10_chr_all.fas.amb -rw-r--r-- 1 root root 682 Aug 24 17:18 TAIR10_chr_all.fas.ann -rw-r--r-- 1 root root 29916939 Aug 24 17:18 TAIR10_chr_all.fas.pac -rw-r--r-- 1 root root 119667836 Aug 24 17:18 TAIR10_chr_all.fas.bwt -rw-r--r-- 1 root root 121183059 Aug 24 17:17 TAIR10_chr_all.fas -rw-r--r-- 1 root root 78102510 Aug 24 17:17 TAIR10_chr_all.fas_17mer.jf *TAIR10_chr_all.fas.bed* is the probe file contained non-overlapped probes. *TAIR10_chr_all.fas_all.bed* is the probe file contained all probes. This file can be used for ChorusNGSfilter. *TAIR10_chr_all.fas.len* is the length info of the given genome chromosomes. This file can be imported into ChorusPBGUI for probe selection. *TAIR10_chr_all.fas_17mer.jf* is the binary file created by jellyfish count using 17-mer. *TAIR10_chr_all.fas_tmp_probe.fa* contains all candidate probe sequences filtered by jellyfish. *.bwt, .pac, .ann, .amb, .sa* files are bwa index files. .. code-block:: log $ more probes/TAIR10_chr_all.fas.bed 1 52 96 TCCCTAAATCTTTAAATCCTACATCCATGAATCCCTAAATACCTA 1 211 255 TTTGAGGTCAATACAAATCCTATTTCTTGTGGTTTTCTTTCCTTC 1 346 390 CCTTAGGGTTGGTTTATCTCAAGAATCTTATTAATTGTTTGGACT 1 426 470 TTTGTGGAAATGTTTGTTCTATCAATTTATCTTTTGTGGGAAAAT 1 496 540 TCTTCGTTGTTGTTACGCTTGTCATCTCATCTCTCAATGATATGG 1 551 595 TAGCATTTATTCTGAAGTTCTTCTGCTTGATGATTTTATCCTTAG There are four columns in each row, first column is chromosome name, second is oligo start site, third is oligo end site, the last one is oligo probe sequence. You can use excel or text editor to open this file. Run Chorus2 in terminal ^^^^^^^^^^^^^^^^^^^^^^^^ **Make a project folder** .. code-block:: bash $ cd ~ $ mkdir sampleproject $ cd sampleproject **Download reference genome** .. code-block:: bash $ wget https://www.arabidopsis.org/download_files/Genes/TAIR10_genome_release/TAIR10_chromosome_files/TAIR10_chr_all.fas **Test chorus2 software** .. code-block:: bash $ Chorus2 -h usage: Chorus2 [-h] [--version] [-j JELLYFISH] [-b BWA] -g GENOME -i INPUT [-s SAVED] [-p PRIMER] [-t THREADS] [-l LENGTH] [--homology HOMOLOGY] [-d DTM] [--skipdtm SKIPDTM] [--step STEP] [--docker DOCKER] [--ploidy PLOIDY] Chorus2 Software for Oligo FISH probe design optional arguments: -h, --help show this help message and exit --version show program\'s version number and exit -j JELLYFISH, --jellyfish JELLYFISH The path where Jellyfish software installed -b BWA, --bwa BWA The path where BWA software installed -g GENOME, --genome GENOME Fasta format genome file, should include all sequences from genome -i INPUT, --input INPUT Fasta format input file, can be whole genome, a chromosome or one region from genome -s SAVED, --save SAVED The output folder for saving results -p PRIMER, --primer PRIMER A specific 5\' labeled R primer for PCR reaction. For example: CGTGGTCGCGTCTCA. (Default is none) -t THREADS, --threads THREADS Number of threads or CPUs to use. (Default: 1) -l LENGTH, --length LENGTH The probe length. (Default: 45) --homology HOMOLOGY The maximum homology(%) between target sequence and probe, range from 50 to 100. (Default: 75) -d DTM, --dtm DTM The minimum value of dTm (hybrid Tm - hairpin Tm), range from 0 to 37. (Default: 10) --skipdtm SKIPDTM skip calculate dtm, for oligo longer than 50. --step STEP The step length for k-mer searching in a sliding window, step length>=1. (Default: 5) --docker DOCKER Only used in Docker version of Chorus --ploidy PLOIDY The ploidy of the given genome (test version). (Default: 2) Example: Chorus2 -i TAIR10_chr_all.fas -g TAIR10_chr_all.fas -t 4 \ -j /opt/software/jellyfish/bin/jellyfish -b /opt/software/bwa/bwa -s sample **Run chorus2 software** .. code-block:: bash $ Chorus2 -i TAIR10_chr_all.fas -g TAIR10_chr_all.fas -t 12 When job finish, the oligo probes will output to 'probes' folder (Default, can be changed using -s) .. code-block:: bash $ cd sample $ ls -lt * total 1741428 -rw-r--r-- 1 root root 280927981 Aug 24 17:44 TAIR10_chr_all.fas_all.bed -rw-r--r-- 1 root root 62050561 Aug 24 17:44 TAIR10_chr_all.fas.bed -rw-r--r-- 1 root root 94 Aug 24 17:30 TAIR10_chr_all.fas.len -rw-r--r-- 1 root root 1031512169 Aug 24 17:22 TAIR10_chr_all.fas_tmp_probe.fa -rw-r--r-- 1 root root 59833928 Aug 24 17:19 TAIR10_chr_all.fas.sa -rw-r--r-- 1 root root 7535 Aug 24 17:18 TAIR10_chr_all.fas.amb -rw-r--r-- 1 root root 682 Aug 24 17:18 TAIR10_chr_all.fas.ann -rw-r--r-- 1 root root 29916939 Aug 24 17:18 TAIR10_chr_all.fas.pac -rw-r--r-- 1 root root 119667836 Aug 24 17:18 TAIR10_chr_all.fas.bwt -rw-r--r-- 1 root root 121183059 Aug 24 17:17 TAIR10_chr_all.fas -rw-r--r-- 1 root root 78102510 Aug 24 17:17 TAIR10_chr_all.fas_17mer.jf *TAIR10_chr_all.fas.bed* is the probe file contained non-overlapped probes. *TAIR10_chr_all.fas_all.bed* is the probe file contained all probes. This file can be used for ChorusNGSfilter. *TAIR10_chr_all.fas.len* is the length info of the given genome chromosomes. This file can be imported into ChorusPBGUI for probe selection. *TAIR10_chr_all.fas_17mer.jf* is the binary file created by jellyfish count using 17-mer. *TAIR10_chr_all.fas_tmp_probe.fa* contains all candidate probe sequences filtered by jellyfish. *.bwt, .pac, .ann, .amb, .sa* files are bwa index files. .. code-block:: log $ more probes/TAIR10_chr_all.fas.bed 1 52 96 TCCCTAAATCTTTAAATCCTACATCCATGAATCCCTAAATACCTA 1 211 255 TTTGAGGTCAATACAAATCCTATTTCTTGTGGTTTTCTTTCCTTC 1 346 390 CCTTAGGGTTGGTTTATCTCAAGAATCTTATTAATTGTTTGGACT 1 426 470 TTTGTGGAAATGTTTGTTCTATCAATTTATCTTTTGTGGGAAAAT 1 496 540 TCTTCGTTGTTGTTACGCTTGTCATCTCATCTCTCAATGATATGG 1 551 595 TAGCATTTATTCTGAAGTTCTTCTGCTTGATGATTTTATCCTTAG There are four columns in each row, first column is chromosome name, second is oligo start site, third is oligo end site, the last one is oligo probe sequence. You can use excel or text editor to open this file. **Further filter using ChorusNGSfilter** To further filter putative repetitive sequences, a kmer-based method can be performed to detect repeats by running ChorusNGSfilter. Before running ChorusNGSfilter, a set of whole-genome shotgun sequencing data is required. Here we download the shotgun reads of Arabidopsis with the accession number SRR5658649. .. code-block:: bash $ wget -c ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR565/009/SRR5658649/SRR5658649_1.fastq.gz $ wget -c ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR565/009/SRR5658649/SRR5658649_2.fastq.gz $ ChorusNGSfilter -i SRR5658649_1.fq.gz,SRR5658649_2.fq.gz -z gz \ -g TAIR10_chr_all.fas -t 12 \ -p probes/TAIR10_chr_all.fas_all.bed -o probes/TAIR10_chr_all_SRR5658649.bed After running NGS filtering, three files (\*.jf, \*.bw, \*.bed) will output to working directory. *TAIR10_chr_all_SRR5658649.bed.jf* is the binary file created by jellyfish count using given k-mer (Default is 17). *TAIR10_chr_all_SRR5658649.bed.bw* is a bigwig file contained all score infomation generated from NGS library. *TAIR10_chr_all_SRR5658649.bed* is the the probe file contained all probes as well as k-mer score and strand. This file should be further selected by ChorusNGSselect. .. code-block:: log $ more probes/TAIR10_chr_all_SRR5658649.bed 1 12 56 AAACCCTAAACCCTAAACCTCTGAATCCTTAATCCCTAAATCCCT 455128 + 1 18 62 TAAACCCTAAACCTCTGAATCCTTAATCCCTAAATCCCTAAATCT 346 + 1 24 68 CTAAACCTCTGAATCCTTAATCCCTAAATCCCTAAATCTTTAAAT 343 + 1 36 80 ATCCTTAATCCCTAAATCCCTAAATCTTTAAATCCTACATCCATG 319 + 1 42 86 AATCCCTAAATCCCTAAATCTTTAAATCCTACATCCATGAATCCC 315 + 1 48 92 TAAATCCCTAAATCTTTAAATCCTACATCCATGAATCCCTAAATA 294 + There are six columns in each row, first four columns are the same as TAIR10_chr_all.fas_all.bed. The fifth column is the k-mer score, last column is target strand of probes. **Automatic probe selection using ChorusNGSselect** Probes should be filtered by kmer score, the process can be done by ChorusNGSselect. .. code-block:: bash $ ChorusNGSselect -i probes/TAIR10_chr_all_SRR5658649.bed \ -o probes/TAIR10_chr_all_SRR5658649_filter.bed ChorusNGSselect will generate a final filtered probe file, it looks this: .. code-block:: log $ more probes/TAIR10_chr_all_SRR5658649_filter.bed 1 36 80 ATCCTTAATCCCTAAATCCCTAAATCTTTAAATCCTACATCCATG 319 + 1 66 110 CGGGTTTAGGGAATTAGGTATTTAGGGATTCATGGATGTAGGATT 221 - 1 215 259 AGGTCAATACAAATCCTATTTCTTGTGGTTTTCTTTCCTTCACTT 293 + 1 245 289 ATAACAAATGAAGATAAACCATCCATAGCTAAGTGAAGGAAAGAA 291 - 1 347 391 CTTAGGGTTGGTTTATCTCAAGAATCTTATTAATTGTTTGGACTG 237 + 1 425 469 TTTTCCCACAAAAGATAAATTGATAGAACAAACATTTCCACAAAG 360 - The final probes can be synthesized directly for oligo-FISH or imported into ChorusPBGUI for further selection. Run Chorus2 with GUI ^^^^^^^^^^^^^^^^^^^^^^^^ **Make a project folder** .. code-block:: bash $ cd ~ $ mkdir sampleproject $ cd sampleproject **Download reference genome** .. code-block:: bash $ wget https://www.arabidopsis.org/download_files/Genes/TAIR10_genome_release/TAIR10_chromosome_files/TAIR10_chr_all.fas **Run ChorusGUI** .. code-block:: bash $ ChorusGUI Set your own parameters and click Run to start the design process. When job finish, the oligo probes will output to Sample Folder where you set. **Further filter using ChorusNGSfilter** The same process as "**Run Chorus2 in terminal**" **Automatic probe selection using ChorusNGSselect** The same process as "**Run Chorus2 in terminal**" **Run ChorusPBGUI** After filtering the probes, users can select suitable number of probes in specific regions for their FISH experiments using ChorusPBGUI easily. .. code-block:: bash $ ChorusPBGUI Use ChorusHomo to design oligo probes for close related species ----------------------------------------------------------------- In this tutorial, we will design oligo probes for potato genome and detect conserved oligos in its close related species, tomato. Run ChorusHomo ****************************** **Make a project folder** .. code-block:: bash $ cd ~ $ mkdir sampleproject $ cd sampleproject **Download Reference Genome file** .. code-block:: bash $ wget http://solanaceae.plantbiology.msu.edu/data/potato_dm_v404_all_pm_un.fasta.zip $ unzip potato_dm_v404_all_pm_un.fasta.zip $ wget ftp://ftp.solgenomics.net/tomato_genome/assembly/build_3.00/S_lycopersicum_chromosomes.3.00.fa **Run Chorus2 to design probes in source species** .. code-block:: bash $ Chorus2 -i potato_dm_v404_all_pm_un.fasta -g potato_dm_v404_all_pm_un.fasta -t 12 -s DM404 **Run ChorusHomo to design probes for close related species** This step requires more memory than Chorus2, thus set the threads smaller will be safer. .. code-block:: bash $ ChorusHomo -ga potato_dm_v404_all_pm_un.fasta -gb S_lycopersicum_chromosomes.3.00.fa \ -i DM404/potato_dm_v404_all_pm_un.fasta_all.bed -t 8 **Check the designed probes** Output files will be saved to \"probes\" folder. The final file *potato_dm_v404_all_pm_un.fasta.homo.csv* contains the conserved probes between potato and tomato genome. The csv file contains 10 data per line: .. code-block:: log $ head probes/potato_dm_v404_all_pm_un.fasta.homo.csv index,probe_seq,genomeA_chr,genomeA_start,genomeA_end,genomeA_identity,genomeB_chr,genomeB_start,genomeB_end,genomeB_identity 1,ATTTTCCATGGACCTCATTAAGATTAGCTATTGAACCAGTTACCC,chr01,97858,97902,0.99,SL3.0ch07,2272165,2272211,0.70 2,ACAGCCAAATCGTCCCATATTCAAGGATAAACGACCCACGAATCA,chr01,103008,103052,0.99,SL3.0ch07,59525112,59525156,0.80 3,ATCTATATCTACTACACCAGAATATTCATACACAAATAAATTACT,chr01,127095,127139,0.99,SL3.0ch06,8431503,8431548,0.83 4,ACTGGAAGTAATATTTTGTCACAGGAATAATTCGGTAAATCTGAG,chr01,127815,127859,0.99,SL3.0ch01,27866488,27866533,0.85 5,AGGATGAAACCGTATTCCAACCTTGCTTTTCCTTTATTGATTAAT,chr01,133524,133568,0.99,SL3.0ch10,9302271,9302317,0.79 6,AAGCAGATATATCGTTCATCATACTTTATTTACATGGGGAAACAA,chr01,133859,133903,0.99,SL3.0ch10,39942300,39942345,0.78 7,TTTCTTGTGCATATTTCTAAATTGTACTGTGCAAAACTTTTCCCT,chr01,134020,134064,0.99,SL3.0ch00,85946,85991,0.83 8,AAATGATTTGCTCTTGACTGTACGTATGCCTGCCGTCTTCGTTGA,chr01,134136,134180,0.99,SL3.0ch01,63698401,63698446,0.74 9,CCTCAAGCTTACCTACAATTAGCATAGGCAGAGTTACAAGTGGAA,chr01,134190,134234,0.99,SL3.0ch01,27863901,27863944,0.91 Column 1 is index, column 2 is probe sequence, column 3-5 are probe chromosome/start/end site in genomeA (source), column 6 is the identity of probe in genomeA, column 7-9 are probe chromosome/start/end site in genomeB (target), column 10 is the identity of probe in genomeB. Users can select high conserved probes (for example, genomeB_identity >= 0.90) for FISH experiments in close related species. Use ChorusNoRef to design oligo probes without a reference genome ----------------------------------------------------------------- In this tutorial, we will design oligo probes for two wild potato species, *S. etuberosum* and *S. jamesii*, the two species do not have reference genomes. Run ChorusNoRef ****************************** **Make a project folder** .. code-block:: bash $ cd ~ $ mkdir sampleproject $ cd sampleproject **Download Genome file of close related species** .. code-block:: bash $ wget http://solanaceae.plantbiology.msu.edu/data/potato_dm_v404_all_pm_un.fasta.zip $ unzip potato_dm_v404_all_pm_un.fasta.zip **Download shotgun sequences of all species (at least 5x reads)** .. code-block:: bash $ wget ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR534/006/SRR5349606/SRR5349606_1.fastq.gz $ wget ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR534/006/SRR5349606/SRR5349606_2.fastq.gz $ wget ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR534/003/SRR5349573/SRR5349573_1.fastq.gz $ wget ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR534/003/SRR5349573/SRR5349573_2.fastq.gz $ wget ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR534/004/SRR5349574/SRR5349574_1.fastq.gz $ wget ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR534/004/SRR5349574/SRR5349574_2.fastq.gz SRR5349606 is from *S. tuberosum* (DM404), SRR5349573 is from *S. etuberosum*, SRR5349574 is from *S. jamesii*. **Run Chorus2, ChorusNGSfilter and ChorusNGSselect to design probes in related species** Run Chorus2 .. code-block:: bash $ Chorus2 -i potato_dm_v404_all_pm_un.fasta -g potato_dm_v404_all_pm_un.fasta -t 12 Run ChorusNGSfilter .. code-block:: bash $ ChorusNGSfilter -g potato_dm_v404_all_pm_un.fasta -i SRR5349606_1.fastq.gz,SRR5349606_2.fastq.gz -t 12 \ -p probes/potato_dm_v404_all_pm_un.fasta_all.bed -o potato_dm_v404_all_pm_un.fasta_kmer.bed Run ChorusNGSselect .. code-block:: bash $ ChorusNGSselect -i potato_dm_v404_all_pm_un.fasta_kmer.bed -o potato_dm_v404_all_pm_un.fasta_kmerfiltered.bed **Run ChorusNoRef to design probes in target species** .. code-block:: bash $ ChorusNoRef -g potato_dm_v404_all_pm_un.fasta -p potato_dm_v404_all_pm_un.fasta_kmerfiltered.bed \ -r1 SRR5349573_1.fastq.gz,SRR5349574_1.fastq.gz -r2 SRR5349573_2.fastq.gz,SRR5349574_2.fastq.gz \ -n etuberosum,jamesii -t 12 **Check the designed probes** Output files will be saved to \"noRefprobes\" folder. 5 files generated. .. code-block:: log $ ls -lh noRefprobes -rw-rw-r-- 1 liu liu 5.2M 6月 28 17:14 etuberosum_indel_probe.txt -rw-rw-r-- 1 liu liu 104M 6月 28 17:14 etuberosum_jamesii_cns_probe.csv -rw-rw-r-- 1 liu liu 62M 6月 28 17:14 etuberosum_probe.txt -rw-rw-r-- 1 liu liu 5.2M 6月 28 17:14 jamesii_indel_probe.txt -rw-rw-r-- 1 liu liu 62M 6月 28 17:14 jamesii_probe.txt drwxrwxr-x 2 liu liu 4.0K 6月 28 16:25 tmp *etuberosum_probe.txt* and *jamesii_probe.txt* are probes with SNPs or identical compared to DM. *etuberosum_indel_probe.txt* and *jamesii_indel_probe.txt* are probes with indels compared to DM. *etuberosum_jamesii_cns_probe.csv* is consensus probes among three species after quality filter. For probes with SNPs: .. code-block:: log $ head -n 3 etuberosum_probe.txt chr00 130544 130588 AGATTTTGCCCATTCTCATGACGCTTTTGTGATTTCAAAACTTTG 366 + AGATTTAGCTCATTTTCATGGCGATTTTGTGATTTCAAGACTTTG 4 chr00 129321 129365 AATACTATTAGATGATGACTAAGAGTAATGCTAGTGTATATAAAT 262 - CTTTATATACACTAGCATTACTCTTAGTCATCATCTAATATTATT 3 chr00 174138 174182 TTATAGTTGTCTAGGATGGAAGGGTTCTTGATTCACTGGTGTTGA 341 - TCAACACTAGCGAATCAAGAACCCTTCCATCCTAGACAACTATAA 2 column 1-3 is location of this probe base on reference genome, column 4 is probe from reference genome, column 5 is kmer score, column 6 is strand, column 7 is probe for *S. etuberosum*, column 8 is how many copy can be found in etuberosum illumina reads. For probes with indels: .. code-block:: log $ head -n 3 etuberosum_probe.txt chr00 298161 298205 TGATGAAGGTGAAAGTAGCATAGATCATGGGGAGTTGTTTGGATT 456 + etuberosum TGATGAAGGTGAAAGTAGCATAGTGCATAGATCATGGGGAGTTGTTTGGATT chr00 298247 298291 GAATGATGAGTCAATCTGATAATTCATAGAATCAAATTTGTATGA 281 + etuberosum GAGTGATGAGTCAATCCATAAAGGCACCTGATAATTCATAGAATCAAATTTGTATTA chr00 298193 298237 TCTTTAATTTACACCATAAAGTTTACTCACAAAATCCAAACAACT 495 - etuberosum AGTTGTTTGGATTTTGTGAAGAGAGCAGTAAACTTTATGGTGTAAATAAAAGA column 1-3 is location of this probe based on reference genome, column 4 is probe from reference genome, column 5 is kmer score, column 6 is strand, column 7 is sample name, column 8 is probe for *S. etuberosum*. For consensus probes: .. code-block:: log $ head -n 3 etuberosum_jamesii_cns_probe.csv chrom,start,end,refseq,etuberosum,jamesii,consensusprobe,consensusscore,consensussite,consensusdiff chr00,130544,130588,AGATTTTGCCCATTCTCATGACGCTTTTGTGATTTCAAAACTTTG,AGATTTAGCTCATTTTCATGGCGATTTTGTGATTTCAAGACTTTG,AGATTTAACCCATTTTCATGGCGCTTTTGTAATTTCAAGACTTTG, AGATTTAGCCCATTTTCATGGCGCTTTTGTGATTTCAAGACTTTG,0.9407407407407408,37,8 chr00,129321,129365,AATACTATTAGATGATGACTAAGAGTAATGCTAGTGTATATAAAT,CTTTATATACACTAGCATTACTCTTAGTCATCATCTAATATTATT,CTTTATATACACTAGCATTACTCTTAGTCATCATCTAATATTGCT, CTTTATATACACTAGCATTACTCTTAGTCATCATCTAATATTAAT,0.7407407407407407,11,35 column 1-3 is location of probe based on reference genome, column 4-6 are probes in DM, etuberosum and jamesii, respectively. consensusprobe means the consensus probe among three species. consensusscore is calculated with fomula\: (probe length * number of species - number of difference) / (probe length * number of species) Consensussite means all identical nt in cns probe. consensusdiff means how many nt different compare with cns probe. Video Tutorials ----------------- Youtube Playlist ***************** Playlist: https://www.youtube.com/playlist?list=PLo8q8tqFX5J27OsuKYFpd-gOtl8Qgf70X Bilibili Playlist ***************** Playlist: https://www.bilibili.com/video/BV1W54y1S7qS/